
After years of hearing stories of problems with HOA's (and having no tolerance for busybodies ourselves) my wife and I were both solidly in agreement that we would never purchase a home in an HOA.
When we finally did find a house and purchased it, we knew for a fact that we were NOT in an HOA. However, just behind us, we learned there was a (not really) HOA. About a week after we moved in, there was a knock on the door. One of the neighbors behind us, announcing that she was President of the HOA, and welcoming us to the neighborhood. Seems civil enough, but we asked, "what HOA."
"Oh, we're behind you, the home behind yours is where the HOA starts."
"Ok, that's nice, nice to meet you..." Just general pleasantries.
We were hopeful. We were shocked, even. Someone associated with the management of an HOA that wasn't a complete busybody psychopath! How wrong we were.
The way our lot was, there was a sliver of green space between our property line and the sidewalk, in a somewhat triangular shape (the street ran west southwest, our property line ran due east-west). So there was a wedge of land there. We'd always been told that this belonged to the HOA, yadda yadda - no big deal, just meant we didn't have to deal with the upkeep of this land.
Now that this set up is all in place, it's time to start the story of how we got the (not really an) HOA dissolved. We had a couple of trees in our yard. Literally on the property line, so we took responsibility for taking care of these things. They're *MASSIVE*. They're also a pain in the butt, incredibly dense/heavy, and because of the way the limbs grow, they're prone to splitting and dropping limbs.
There was a huge limb that extended way out into the street adjacent to the green space owned by the HOA. This thing was a major risk of dropping and severely injuring/killing someone. We didn't want that on our conscience (or our insurance!) and so we decided to take that limb down entirely, as well as clean out a lot of the deadwood in the two trees.
Hired an arborist, they came out, did their thing. $1400 later, we were left with some decent sized rounds that we were going to move over the next weekend (I was out of town the first weekend after we removed the limb). I should not that the wood was neatly stacked in the green space on the barkdust, out of everyone's way, and in no way a hazard or eyesore.
Enter the shrieking harpy...er.. .President of the "HOA". My wife had stepped out the door the day I had left on my trip and she pulls up into our driveway, rolls down the window, and starts yelling at my wife: "YOU NEED TO MOVE THAT WOOD NOW!!!!! THAT'S PRIVATE PROPERTY OF THE HOA!!! MOVE IT NOW!!!!"
My wife is *not* a confrontational type. She's also somewhat petite, and tried to explain to the harpy that I was out of town and that we would be moving it as soon as I got back in town the next weekend.
Nope, not good enough. She shrieks at my wife some more, and my wife ends up grabbing the wheelbarrow and somehow moves this stack of rounds (some of them weighed close to 100 lbs) around the fence, up our driveway, and into the backyard. She was pissed.
So was I. We knew where the harpy lived, so when I got back I went over to talk to her, and explain that I was rather displeased in how she treated my wife. Didn't pound on the door, wasn't aggressive or anything. They wouldn't answer the door. Cowards (we knew they were home).
This left us with a bit of a displeased taste in our mouth. The next spring, the hedge that is planted outside of our fenceline, well, it wasn't maintained very well, and pushed over two sections of our wooden fence. So I emailed the harpy and explained that their hedge had damaged our fence.
"It's not our hedge!"
"um... it's growing in your green space"
"That's not our green space!"
Waitwut?
"Then why the [censored] did you decide to screech at my wife last summer when we had the wood stacked there
Silence.
Well, at that point I fixed the fence so our dog wouldn't escape, after pruning the laurel back sufficiently that it wouldn't damage the fence again. And started making some phone calls.
I contacted the county, and ended up speaking to about seven different departments in order to figure out who actually owned that strip of land. After probably two weeks of trying to find the right people to talk to, I got to the roads division. The green space was marked as part of the right of way for the road, and therefore no one actually "owned" that space.
"So I can chop down that ugly overgrown hedge that's encroaching on the sidewalk and knocking down my fence?"
"Yep," says the kind gentleman from the roads division.
"As an aside," he asked, "you mentioned something about there being an HOA associated with the plots to the east of your property?"
"Yeah?"
"well, part of what took me so long to get an answer for you is that it turns out there is no HOA registered with the county there, so we were looking in the wrong place entirely......"
"Wait, there's no HOA there?"
"No, hasn't ever been one since that subdivision was built..."
"Huh.... Interesting...."
And a plot was hatched. We had befriended a couple of people within the neighborhood behind us, and they were rather fed up with Ms. "President of the HOA" and her antics. She was the typical busybody, bullying anyone she didn't like, and apparently for the last 10 years or so had been collecting HOA "dues" from everyone in the neighborhood to the tune of $300/year.
There were 36 homes in the "HOA". Right around $100,000 in dues. For a non-existent HOA. With no real maintenance. Oh, they hosted an annual block party - potluck style...They pulled weeds from the green space - on a volunteer basis.
So I did what any red-blooded American would do. I got 36 envelopes. 36 stamps. And printed off 36 copies of a letter with my findings from the county that there was not now, nor ever had been for the recorded history of the subdivision, any HOA, neighborhood association, or any similar organization.
And that they, collectively, had paid in excess of $100,000 in dues over that time to a non-existent entity, plus any fines the non-existent HOA had decided to levy. The neighbors, in turn, did exactly what any red-blooded American would do. They sued the hell out of her for every penny they'd paid over the last 10 years. Won, too. And there's no longer an "HOA" behind us.
Also, I forgot to mention this. In all the digging into this mess, we learned she's a real estate agent. I figure I'll wait until she pisses me off again and report this whole mess to the state's real estate licensing board. *evil grin*. As others have pointed out, this needs to be reported to the licensing board. Will look into that process....
I have sent an initial e-mail to my state's Real Estate licensing board (Real Estate Agency), and will post any updates as things develop. I did look her up in the licensing system, apparently she's licensed as a principal broker for her agency. This should get interesting.
And this should be interesting - her license is up for renewal at the end of this month. This should put one hell of a speed bump in that process. *evil grin* Regarding the criminal charges, since I wasn't a victim of the fraud, that's not something I can pursue.
However, I spoke w/ my friend who was one of her victims and he and his wife are talking to other people they trust about coming together and seeking criminal charges.
Today, my wife and I had dinner with our friends who were among the victims of this psycho. And I learned a lot.
Probablydefinitely more than I should have. I learned a lot about the lawsuit that was filed when I sent out the letters revealing that there was no HOA.
There was, in fact, a settlement to make the lawsuit go away. I will say this, the Harpy got a good lawyer. A *really* good lawyer. One of the terms of the settlement was that the total amount remain undisclosed, but our friends confirmed that they were made whole. Another part of the settlement was a pretty stringent non-disclosure agreement.
I'm gonna have to start pretty far back in this mess, because it explains a lot about how this all went down. The subdivision that Harpy lives in was built back in 2000. And it turns out that at the time the subdivision was built, she was the first one to buy in this brand new neighborhood.
The developer had actually planned to set up an HOA (the correct way) but because of delays in construction and selling the homes, they never actually set it up.[Based on one of the comments below and a glance at the relevant state law, this is apparently bad information that was passed on to me.] That didn't stop Ms. Harpy though, not at all.
So as soon as the next owners moved in, she reached out to them. "Hi, welcome to the neighborhood. We are setting up a neighborhood association, a voluntary HOA if you will. That way we can take care of the common areas, and keep property values up." The usual excuses behind an HOA.
Well, after the first 5-6 houses were bought and the owners moved in, and agreed to this voluntary "HOA", well... The pitch changed. It went from a "neighborhood association" to just a straight, "Hey, welcome to the neighborhood. I'm the president of the HOA, nice to meet you!" Most people went along with it. They figured they had missed something in the disclosures, or in the listing, or something.
But this was a brand spanking new subdivision. And at the time, you couldn't find a brand new subdivision that *didn't* have an HOA. There were a few people that *did* in fact pay attention. When called on it, she would change her pitch back to the "Well, it's not *really* an HOA.... It's more a voluntary neighborhood association...
But we do have some rules we've all agreed to (that it turns out she wrote all on her own), and we do collect a small amount of money, just $25 a month, that's not unreasonable, is it? Just to keep up the common areas, and the rules help keep everyone's property values up!" All of that came to light during the depositions and testimony in this lawsuit.
And she sold them on it. Everyone signed the "rules" (She even called them CC&R's - with the argument that this gave them a certain legal weight to be able to enforce the rules), either under the guise of the "HOA", or the "Neighborhood Association". By the time all the properties were initially sold, it was roughly 2:1, those that thought it was an HOA, and those that thought it was just a voluntary association.
And as people sold, and new owners moved in, well, the HOA pitch just got easier to sell. To the point that at the time of the lawsuit, it was somewhere between 3:1 and 4:1.
As testimony was wrapping up, her attorney put forward a proposed settlement. I was able to find out from my neighbor that in this proposed settlement the only people that would be, in the legal jargon, "made whole" were the ones that signed on under the impression that it was a legitimate HOA.
Her attorney successfully argued to the judge that the people who signed up under the "voluntary neighborhood association" were not actually defrauded, and therefore couldn't be a part of the settlement. That *really* pissed off those people.
Because of the timing of the whole house of cards tumbling down around her, she had sufficient equity in her house that she was able to refinance her mortgage and pay the settlement amount. So she had to pay a lot of people back out of her own pocket, losing that equity that she had built up over the last ten years.
I'm guessing that her husband was *not* in on the scam, as he was not one of the named parties in the suit, and he filed for divorce in the middle of the lawsuit. As for how he didn't know? No clue.
Maybe she just had him convinced that her commissions from real estate sales were just that good. I have no idea what the terms of the divorce were, but it was apparently rather acrimonious. Our friends more than once heard shouting matches from the Harpy's house as they were out walking the neighborhood.
So hopefully that clarifies how she was able to sucker people in. Our friends were some of those that were convinced that it was a legitimate HOA, and they told us that she was so smooth, so convincing, that they didn't doubt it for a minute. At least that meant that they were "made whole" even though they couldn't legally disclose how much they got back.
Now, for more recent happenings. One of the things we talked about tonight was our neighbors going to the district attorney and pursuing criminal charges. Well, they talked to the DA's office this morning, and apparently the statute of limitations has passed. For a crime like this, even though it would be a felony level charge, the statute of limitations is only 3 years for that type of crime.
BUT I passed on to them the idea of reporting her to the IRS. Since they were among those who lost money, I figure it's only fair that they get the reward if there is one. They both got a rather gleeful look at that idea. So yeah, that should be interesting.
One of the reasons that I said the Harpy got a good lawyer was that one of the terms of the non-disclosure agreement was that if they signed on to the settlement, they agreed not to report her to any professional board or any licensing agency. So she obviously had concerns that something like this might possibly, just maybe, perhaps have an impact on her license as a real estate agent.
Too bad for her that I wasn't part of that settlement. Because after my initial email to the state Real Estate Agency, I got a response back this morning, and after a couple of more e-mails back and forth, I was interviewed over the phone by the head of the professional standards division.
They appeared to be *very* interested to hear what I had to say. I gave a recorded statement on the grounds that it would remain confidential (don't want her trying to make my life a living hell).
And at dinner tonight, I learned that our friends have a pretty good friendship with several of the people that were *NOT* paid off in the settlement agreement, since they signed up under the "voluntary neighborhood association". The ones her lawyer insisted were not defrauded and therefore couldn't be part of the settlement. Which means they also are not covered under that pesky little non-disclosure agreement.
Before I started writing this update, I e-mailed the names and contact information for three of those owners who still live in the neighborhood to the head of the professional standards division. Because while I had to deal with her craziness and general pain-in-the-buttitude, I didn't actually lose any money.
But actual victims of her scam? I imagine their testimony will carry quite a bit more weight with professional standards. I also (solely for their convenience) included the state court case number for the lawsuit. Who knows, maybe they can see the records of the lawsuit and the terms of the settlement since they are a state agency.
That, kind strangers, brings us up to today. If I hear more updates (which hopefully I will through my friends) I will gladly share them here, and I'll happily answer any questions I can.
And now, for Part 3 ladies and gentlemen, a couple of new characters have been introduced. Government agencies have gotten involved. My friend and neighbor texted me this afternoon, saying only, "CALL ME!!!" As soon as I was able to, I gave him a call. And he could barely stop chuckling.
He caught me up a bit. After we'd talked the other evening, he'd started talking to some of the people in the neighborhood. And it turns out that Ms. Harpy of the Not-Really-an-HOA is apparently kind of a slow learner.
Because in the last couple-three years, while she hasn't tried to bilk anyone else out of their money, some of the newer owners in the neighborhood were being told that there was still a "neighborhood association" and she kept trying to enforce arbitrary rules on people.
Except everyone had heard about her antics. And promptly told her to get bent. So if anything, her nonsense has actually created a more cohesive neighborhood. Everyone is united in hating her! :D
But that's not the reason he was chuckling. He was chuckling because he'd just gotten off the phone with an IRS agent. Now normally, that's not your expected reaction when speaking to anyone from the government with the word "Agent" attached to their title in any way. But no.
He was chuckling after he spent over an hour on the phone detailing everything he knew about her dealings as "president of the HOA". As well as providing contact info for quite a few others in the neighborhood who knew what had happened over the years. I *really* hope I get to hear more about what happens with the IRS.
As if that wasn't enough good news, I popped over to the state real estate licensing board website (I've been checking it every day since I spoke to the head of professional standards) and saw a paper with some revealing information...
From a little cursory reading of state law and associated regulations, this decision is temporary until the full investigation is completed. Once that happens, the professional standards board will decide if there is to be permanent action against her license.
If there is, then there will be a date in the "order signed date" column, and a *really* entertaining link in the "documents" column in the disciplinary action section that lays out the entire case, from start to finish. (I've read a couple of documents in other cases I found where there was a final order - and wow, they lay *EVERYTHING* out).
So there we have it. I was almost kinda feeling bad for bringing up stuff from years ago to government agencies, but the fact that she is *still* trying to pull off this crap (albeit without the money part) made any of that evaporate like the HOA she thought she had.
So it may be the end, or it may not, but at least for now, we've reached the conclusion of the saga of the Harpy of the Not-Really-an-HOA.
When last we left Ms. Harpy, she was being investigated by the state Real Estate Licensing board, as well as the IRS. Well, I learned something interesting in this whole saga. Apparently, while the statute for limitations for criminal tax evasion is only three years (or possibly 6 years, depending on the situation), there is apparently no statute of limitations on how far back they can go in civil court. So while she may dodge any federal charges of tax evasion, the IRS will be crawling up in her business however the heck far they want. I suspect that will end.. poorly (and expensively) for her.
Additionally, the state department of revenue has also caught wind of this. Can't imagine how that may have happened. Similar to the feds, while they can't charge her criminally on the tax evasion, I'm sure they also will be digging through all of her tax records for the last, oh, FOREVER.....
I've already had an interview with a rather pleasant IRS agent, and was able to go through everything that I knew, the timeline for what happened, and how it was that I discovered there was not an actual HOA there. When I explained how this all started because she decided to be a bitch about a couple of relatively small issues, and it has since snowballed into, well, THIS, she (the agent) laughed so hard it took us several minutes to get back on track. And she continued to chuckle and giggle throughout the rest of the interview.
And the state department of revenue has contacted me as well, wanting to set up a time for an in person meeting. So that will be fun. :)
I've considered going to the local news media about this as some suggested, but decided against it for a couple of reasons. The story isn't really as fresh as it was 7 or so years ago when it was all going down, and I doubt the news medias ability to keep my name out of it... Maybe not on the air, but somehow it would slip. And that would add needless complication to my life. If somehow she avoids getting her real estate license revoked, maybe that will change the equation enough to where it might be worth letting the media know. Plus it gives them a recent hook to tie the story into. "State Real Estate board refuses to revoke license of crooked agent! News at 11!". You get the gist.
I don't have the screenshot of it, but on the state licensing board website, there's three new items in the "Disciplinary action" section of her license. An additional proposed suspension sanction, and two proposed revocation sanctions. I'm guessing the second proposed suspension is so she can't default back to a "regular" real estate agent. And the proposed revocation sanctions are for her Principal Broker and regular Real Estate agent licenses as well. So that will be interesting to see what happens once it's finalized. I imagine that process will not be quick. Once I get home tonight and have a chance to redact the relevant information from the screenshot, I'll post that as well.
I've heard through my friend who lives in the subdivision that there have been several people contacted by the state Real Estate board, as well as the state department of revenue and the IRS to set up interviews (and some have already been completed).
And just out of curiosity, I checked the website for the local branch of the national real estate company she works for. And lo and behold, she's no longer listed on there as either the principal broker or an agent, and someone else is listed as principal broker. I'm going to take this development as a cautious agency making sure they don't get caught up in any legal messes. But I think someone just learned the lesson, "you are merely a cog in this machine. you are easily replaced."
In a final bit of entertainment for this saga, I was shown several screenshots by my friend of a post in the subdivision's Facebook page that was quite, well, I guess entertaining would be a great word. She's since deleted the post, but essentially she was on there shrieking about how they were "all" under a non-disclosure agreement, and she was apparently threatening to sue any of them that talked to anyone for violation of the NDA. This was met by cricket chirps from anyone who knew what was going on, but there were several "what the hell is she talking about" type of posts by a few of the newer owners who weren't in the know. But my favorite response was by someone who apparently is an attorney (based on how they phrased things) who wasn't here when the not-an-HOA was in effect (she's only lived in the neighborhood for about a year) but apparently caught a quick heads up from somebody. The short version of her post was that while she wasn't aware of the particulars of what was going on, she stated that NDA's don't cover someone answering questions from a regulatory or investigatory agency, either state or federal, as well as not covering any testimony being given under oath. And trying to bully someone into not speaking to such an agency by means of an NDA or otherwise might even be considered witness tampering or intimidation. And a few hours later the Harpy's post (and all the associated replies) mysteriously disappeared... But you know, FB will gladly hand over the whole conversation with a subpoena. And the IRS does not mess around with the possibility of witness tampering. So maybe she might end up facing criminal charges after all. Depends on how stupid she gets, I guess. If past performance is any kind of indicator, she may very well get to spend some time in the gray bar hotel.
The state Real Estate Agency has finalized their orders on her license. Folks, I wish I could share the text of the final orders associated with this action. But because it is public record, it is also searchable, and would all too easily reveal her identity and open the doors to headaches for me and my family. So I'll summarize.
The first revocation for Fraud or Dishonest Conduct and Failure to Disclose is of her Principal Broker license. The second revocation, for Incompetence or Untrustworthiness and Records, that's for her regular real estate agent license. There are some bombshells in the final orders.
Apparently, as a few people suspected in the comments, there was a lot more happening than just what was happening in her neighborhood. I was shocked at how quickly the final order was released (from what I was seeing in other cases of revocations, the investigation usually lasts anywhere from three to six months).
But reading the final orders, the Principal Broker revocation was based mostly on the information in the lawsuit that was filed by the neighbors back in 2012 and the ensuing settlement.
However, their investigation apparently turned up quite a bit of other STUFF. Including lying to clients, falsifying records, not disclosing relationship between herself and sellers or buyers, and other instances of outright fraud. I will quote one line nearly verbatim from both final orders... Because it's just so delicious to read:
"While this Board has taken the strongest action granted by the [APPLICABLE STATE STATUTES], much of the information that was discovered during the course of this Board's investigation is beyond the purview of this Board. Therefore we are turning over all records and witness testimony to the [REDACTED] County District Attorney and the [STATE REDACTED] Department of Justice, Criminal Justice Division for further action."
IRS agents arrived bright and early yesterday morning at the Harpy's house. Including two from the IRS's Criminal Investigation Division. These are people with arrest power, by the way. And yeah, that's important later in the day.
When I left for work Friday morning, the two IRS-CID agents were walking up to the Harpy's house. I texted my neighbor and friend who lives with a line of sight to her house, and he started sending me updates throughout the day. After the initial pair of agents arrived, another SUV arrived with several more agents. These were apparently there to collect evidence.
Now, I need to briefly back up a few months before the psycho's world started to come crashing down. I had noticed a brand new Mercedes SUV driving around the neighborhood, but really didn't think anything of it.
Never paid attention to who was driving it, and really couldn't care. Well, it turns out that before the excrement hit the rotating wind vectoring device, she was living high on the hog, and went out and bought herself a brand new shiny SUV.
Among all of the evidence gathered Friday, they were looking pretty hard at that SUV. According to my friend, several pictures were taken, clipboards consulted, and a lot of looking at the area of the windshield where one would find the VIN.
Around mid-day, the agents that didn't have "Special Agent" on their jackets began hauling out boxes sealed with red tape to their SUV. Several boxes. As well as at least one computer tower, and he thinks a laptop as well.
I thought that my day was made. I really did. But Friday evening, my day got oh-so-much better. My friend came over and told me he had something to show me. He pulled out his phone, and gave me an absolute crap-eating grin. He made me wait for it. It was worth it.
Dear readers, I got to watch video that my friend shot from his living room window, of the Harpy. Lil' miss President of the Not-Really-an-HOA. Oh, and an absolute bitch to boot, I got to see video of her doing the perp walk.
I got to watch her be marched, obviously ranting and yelling, and stuffed into the back of a Federal Law Enforcement SUV. Word spread fast through the neighborhood. The scuttlebutt is mostly along the lines of "Interfering with the duties of a Federal Agent."
Unsurprisingly, she was released on either bond or recognizance this morning. But she got to spend a night in jail. And she's managed to dig her legal hole just that much deeper.
And there was just one last bit of schadenfreude this afternoon. I was out working in my backyard, and from my yard, I can see the side of her house. So I'm out there, and a flatbed tow truck comes up the street. Didn't think much of it, until I glanced over again, and happen to see it stopped in front of the Harpy's house.
With a county Sheriff's Office cruiser parked there. (Guess they were helping out the IRS). I say that because that flatbed loaded up that brand new, not even a year old Mercedes SUV. With the Sheriff's deputy standing there the whole time. She was *not* allowed to remove any personal belongings from the SUV.
She was not allowed within 10 yards of it, or of the tow truck, or the tow driver. As the driver was turning around to head back out of the neighborhood, I could see that she was on her phone. And clear as day, I heard her ask/shout "WHAT DO YOU MEAN, EVIDENCE!!!"
My house is about half a block from hers. As her shiny SUV was towed away, it drove past my yard. She was watching it drive away, and then saw me in my yard. I couldn't help myself. I smiled, and waved. She flipped me off, turned on her heel, and stomped away. I've had a permanent grin the rest of the day.
Ladies and Gentlemen, this has been one helluva ride. But I think I may have won. Finally. As of last weekend, the Harpy's house has a "For Sale By Owner" sign in front of it. I wanted to wait and make as comprehensive update as I could. This morning, I got the call I was waiting for from my lawyer (although much more quickly than I was expecting this to all end.).
The Harpy decided to sue me. Tortious interference with business relationship. Tortious interference with contractual relationship. Intentional infliction of emotional harm. Loss of consortium (apparently this whole mess falling down around her ears caused her husband to divorce her). A couple of other things, but those were the high points.
So this psycho decides to sue us for just over $100,000.... Not sure where she came up with that number exactly, but it was enough to cause my eyebrows to raise just a little bit. After my initial panic, I read through the complaint thoroughly. And realized that she had absolutely no evidence.
Just a bunch of conjecture and assumption. She was guessing that I was the one who had initially mailed out the letter that revealed the sham HOA. And based the entire lawsuit on that guess. But she had absolutely no proof.
Ok. Lawyering up time. I have a pre-paid legal service through my work, so I got the initial consultation provided by that, and after reading through the actual filings and complaint, my attorney started to laugh, and then got a very malicious look on her face.
I told her the entire story, told her about the reddit posts, she read through them and felt that while they could all be tied together into a cohesive picture, that all depended on having some kind of evidence to start with.
Assuming the Harpy somehow caught wind of these posts, in her opinion there wasn't enough to even send a subpoena to reddit to get my e-mail address. Not that it would have gotten the Harpy much, since there's not really any obvious link between that particular e-mail address and my actual name.
Again, lots of conjecture, but nothing that could be entered into evidence in court. Why the laughter and then malice? Simple. Our state has a particularly robust "anti-SLAPP" ordinance in place. For those not familiar with the term, "SLAPP" is a "strategic lawsuit against public participation."
You hear about those lawsuits meant to just keep people quiet? Yeah, that's a SLAPP lawsuit. Essentially it's trying to use the legal system to punish you for exercising your free speech rights.
So my attorney explains this to me in great detail. The short version of it is, the way the law is written, Harpy and her attorney now need to prove that this is not a lawsuit that is meant to deter participation in a public venue. This is *really* hard to prove in this case. We're not sure what their plan was , maybe try for a quick settlement or something.
I can pretty much guarantee that their plans did *not* include an attorney with a lot of experience in SLAPP litigation. It certainly didn't help that the case was assigned to a judge that my attorney had argued in front of before, and she knew that this judge did not take very kindly to people attempting to weaponize the legal system.
I'm not familiar enough with the legal jargon and the finesse of "legalese", but my attorney read through the complaint muttering things like "amateur" and "idiot". It was painfully obvious (at least to her) that this attorney was not exactly... "experienced."
This became all the more evident once we got to our first hearing. We went before the judge in late December, just before the court took a break for the holidays (at least for civil matters - this delayed further proceedings in our case until last week).
During our first hearing, after her attorney (badly) made his opening statement, my attorney got up there. And she absolutely destroyed him. I'm going to have to get a copy of the transcript and study it because some of the verbal judo she used was just a masterpiece.
She tore the entirety of their case apart in about 15 minutes. There was absolutely no evidence, there was no way at that point to obtain any evidence to bolster their case, and it is obvious that this lawsuit was the legal equivalent of throwing crap at the wall to see if anything stuck. Then came the coup de grace.
"Your honor, we would like to file a counter suit under [relevant state ordinance]. This is clearly a "SLAPP" suit, based on [multitude of legal citations and references] that is intended to stifle my clients right to free speech under both the [state] constitution as well as the United States Constitution.
Even if my client had made all the statements the plaintiff alleges, which we do not admit to, they would be protected speech based on [lots of case citations]. As such, we are serving notice of our intent to seek not only attorney's fees and compensatory damages for my client's time lost from work, but also punitive damages under [multiple case citations]."
(This is not an exact quote, I may update it if I get a copy of the court transcripts.) As soon as she mentioned that specific state ordinance, Harpy's attorney started to look a little nervous. But it was nothing compared to the look on the Harpy's face when my attorney mentioned the counter-suit. Panic probably covers that best.
We were standing outside the courtroom after submitting our discovery request, etc with the court clerk for the counter-suit. We saw the Harpy and her attorney at the far end of the hall, and she was obviously tearing into him, albeit quietly. But you could tell she was *pissed*. She saw me looking at them, grabbed him, and walked away.
At this point, I had expected to wait at least a month, maybe even longer before we got our next hearing. The Harpy's attorney provided the documents we had asked for though, and so my attorney and I went over them one afternoon.
At this point, we had not yet set an amount we were countersuing for, but my attorney was saying that about $10,000 was probably what we would end up at provided that they didn't drag the case out and increase the billable hours/lost time figure. We weren't looking to break her, but we wanted at a minimum attorney's fees and my lost work time.
That was probably about $4k at that point all together. Add in a few thousand for punitive damages, and we came up to that figure. But after reviewing the discovery documents we realized that Harpy was most likely not only flat broke, but drowning in debt.
Last week, my attorney got a phone call from her attorney. They were looking for a quick settlement. But now it was the other way around. They were hoping we would be content with a quick settlement, and were looking for what it would take to just make this all go away.
They realized that with the anti-SLAPP motion we had them over a barrel, and that she had absolutely no proof that I was the one involved anyways. They knew they were hosed, so they had made a request to the judge to dismiss their lawsuit. But because we had hit them with the anti-SLAPP counter, they now had to convince us to drop our suit.
My attorney talked it over with me, and we agreed to let it go strictly at costs incurred. At that point we had gotten up to about $5k. And my attorney wrote the settlement offer in such a way that the Harpy owes the money to the attorney directly, instead of making me pay her and then try to
squeeze water from a stoneget paid myself.
Darn nice of her, I thought. I know I'm probably not going to see the money that's owed me for lost time, but I used vacation time for those days, so I'm not really out the money, just out the accrued vacation time. Would be nice to get some of that back in the form of money, but it's doubtful. Maybe in 10 years that judgement will finally get paid. Who knows.
My attorney called me this morning. The judge approved the settlement. The case was dismissed with prejudice (one of the conditions of our settlement) meaning the Harpy can't ever try to come back at me again for it. Also a no contact order against her.
Just for grins...Would love to get her arrested for violating that order, but she's still looking at the potential for time in the greybar hotel for her IRS shenanigans. So that makes me smile a bit.
Now, back to the listing on her home. Since she still has some contacts in the real estate world, even though her home is a for sale by owner, she managed to get it listed in the regional MLS with her as the contact for the "listing agent". The interesting bit about that is that she's very obviously in dire financial straights. Refinances in our county show up as "sales" in the public title history for a home.
So looking at when my wife and I refinanced our home, we can see how much the house was "sold" for as the refinance on sites like Zillow. So I looked at the history for her home. She refi'd it around the time of the settlement to the neighborhood for the original fraudulent "HOA" scheme for very close to Zillow's estimate of what the home was worth.
So I'm guessing she cashed out most, if not all of her equity in the home to pay for that settlement. The house is currently being listed for about 10% higher than the current Zillow estimate ...
(yeah, I know those are pretty darn unreliable) but the real interesting thing is on the MLS listing, there's a spot where you have to disclose whether it's a short sale or a Bank owned property. And sure 'nuff, under Short Sale? It says "YES."
Let that sink in. She's trying to sell this house for about 10% more than it appears to be worth, and it's *still* less than what she owes the bank.. I think I'll wait until I get home tonight, and then make a quick phone call to the MLS folks and let them know she's no longer a licensed real estate agent and that her listing is a For Sale By Owner.
Most of the courts in our area have slowed way down because of 2020. Criminal cases are still proceeding in some instances, but not all. Federal courts have been hit or miss, but things have been slowly grinding through. I hadn't really planned on any more updates until the legal proceedings were all wrapped up, but we had some excitement happen a few days ago that I thought this group might appreciate.
We had put a few cameras around our place after a utility trailer was stolen, and they're set up to alert us when they detect motion inside our property line (roughly - the zones start between 2 and 10 feet inside our property line depending on the camera angle).
So after getting the kiddos to bed, the Mrs. and I were settling in to watch a little TV when my phone pinged with a motion alert. I pull it up and, sure enough, that sure looks like little Ms. Harpy
comingstumbling up our driveway. Camera is in black and white mode since it's after dark, so we can't be sure. So she gets to the front door and that camera has enough light to show color, and sure as hell, it's her. What the hell?
If you remember in part 6, part of the settlement was a no-contact order against this psycho. I ask my wife to go get our copy of the order out of the filing cabinet, grab a weapon and holster out of the safe real quick (licensed, don't worry) and throw it on under my sweatshirt.
I don't trust this psycho for one second, and I have no idea what the hell she's doing. I'm on the phone with 911 already, asking them to send the county sheriff since I have a no contact order and the subject of that order is now on my front porch loudly banging on my door.
Now, I admit that I made a mistake here. I did not want her to wake up my girls, so I put the 911 dispatcher on speaker, put the phone in my front pocket, and opened the door. Told her to step off my porch. I should have just left the psycho pounding on the door until the deputies arrived. Thankfully, my mistake did not bite me in the butt. And it did give me a front row seat for the shenanigans that were about to follow.
I'm not sure exactly how much she drank. But she was beyond drunk. She was blasted. She reeked of booze as if she'd been marinating for a couple of days. Maybe longer. And of course, being that drunk, she was loud.
I ask her to step away from my house some more so we can talk. Well, I talk, she yells. Basically what it boiled down to is (translated from drunk) that I ruined her life, that I'm the reason she's losing her house, I'm the reason she's going to jail (she didn't know it, but that was foreshadowing), I'm the reason the IRS is on her, that she lost her marriage, her career, her car, everything.
This drunk soliloquy took over 7 minutes according to my cameras. She caps it off with "and maybe I should just off myself right here right now and maybe you'd be happy with that too!".
Well, crap. I'm now worried that she's got a knife, or some other weapon. I *really* don't want to have to draw on her, or worse. But I'm hearing the deputies coming (they stepped up their response to lights and sirens when she threatened to kill herself).
So I know they're close, and I'm trying to verbally de-escalate her. Basically just trying to stall and let them come deal with her. I've backed up several more feet to open distance between us and am just hoping the deputies get here soon. All the time I've got an open line with 911 still on speaker phone.
She continues her drunken rambling until the deputies show up about a minute later, mostly about how it's just "aaaaaaaall my fault". But now her drunk and belligerent escalates up a notch or 5, as she's realized that I must have called the deputies. She starts cussing at me, at them, at life in general.
It's a pretty spectacular drunken raving. Kinda made me wish my cameras recorded audio. They are trying to get her attention, they're trying to get her to cooperate with their commands, and I'm backing away from her, telling her to talk to them. Well, pretty quick they realize she's gonna be one of *those* cases. So one of them draws their tazer and starts giving more... Forceful commands.
Well, apparently little miss President of the Not-really-an-HOA really doesn't like being talked to in that tone. Especially not when she's drunk. So she turns to the deputies and starts giving them a piece of her mind. They're ordering her to put her hands up, etc, and she decides that she really wants to get closer to them to yell at them some more. Two steps.
Two steps, and then I hear the oh so distinctive "POPtactactactactactactactactac" of a tazer being deployed. Stiff as a board, her momentum proceeds to topple her forwards and she faceplants right into my front lawn. Then she's at the bottom of I'd guess a 350+ lb pile of law enforcement and their assorted gear while they cuff her.
She's wailing, crying, and I'm just in shock at how crazy this night has gone. Eventually she's stuffed into the back of one of their patrol cars and they come talk to me to figure out just what the hell was going on. By this point my wife has handed me our copy of the no contact order, which I show them and explain (briefly) what all has gone on that has led up to this point.
The deputies go and try to talk to her, but she's just blabbering and crying now. Something else to realize is that with the issues we're having, they're not really taking people to jail for more minor infractions, it's just a citation to appear at such and such date.
So I figure they'll take her over But after running her through NCIC/LEDS, turns out that violating the no-contact order puts her in violation of the terms of her bail from when the IRS agents were there gathering evidence. Whoopsie.
As of yesterday, she was still showing lodged in the county jail (our county has searchable lists of anyone in the jail), and on top of everything else, she's now been charged with violating a no-contact order and her bail has been revoked.
Also from what the deputies were saying, on the off chance she is going to be released, since I'm the protected party on the no-contact order, I will be notified. I do believe she has picked that shovel back up and dug her hole that much deeper.
She was released from jail approximately three weeks after this incident. We had a video conference with the judge, and she was not amused by Ms. Harpy's antics. Yes, my video recording of the incident (with the audio from the 911 call) were the prosecutors star witnesses.
She made it abundantly clear that if it weren't for the current mess with 2020, she'd have kept Ms. Harpy in the county jail until she went to trial for the various charges. She did strengthen the protective order a bit. It was actually rather hilarious. She asked me exactly how far the Harpy's property line was from ours.
A quick look at google maps and we had our answer "75 feet, your honor." The judge then told her that she was to come no closer than 75 feet from our property line in any instance, and that other than when she was at home, she was to maintain 300 feet from us at any given time.
The Harpy had the audacity to whine "but that's the route I take to leave the neighborhood!" The judge asked her if there was another way out of the neighborhood. "Yes." "Then I suggest you take that route," the judge replied. It adds about 5 minutes to going anywhere from our area - she has to weave through a lot of residential side streets. Nothing earth-shattering, but certainly annoying.
The house is still listed for sale by owner. Not surprising, since she's asking about 15% higher than similar houses have sold for in our neighborhood. She also has not dropped the price at all. I've seen some serious people in serious looking suits out at her place, so I suspect foreclosure may be coming down the pipe.
I haven't heard a peep regarding the federal charges she may be facing. I do know that to say the courts are moving at a glacial pace would be an understatement. I suspect that it may take a year or more for this part to process through.
Plus the possibilities of appeals, etc. Ultimately, I am shocked at how this whole thing has snowballed. All over being bitchy to my wife. I suspect there's a lesson in there somewhere. :)
Due to 2020, courts in my state have been moving at a rather slow pace on civil cases, but criminal cases have resumed... And so recently I had the privilege of sitting in the witness box at our local courthouse, and got to explain to a judge and jury what this insane ride was (I wasn't one of the primary witnesses, I was more for the wrap up of the prosecutor's case.
Most of the testimony came from not only her previous victims who lived in the fake HOA, but also other people she has defrauded over the years. It took three days just to get through all of the victims testimony.
I was the final witness, and the prosecutor had already gotten the approval of the judge for my testimony, since while some of what I was going to testify to was second hand, it was corroborating the testimony of the actual victims, and really just wrapped the whole case up in a nice neat little package.
So I got to sit there, and tell this whole saga, from start to finish. I don't think the jury even blinked. The defense attorney tried to object a couple of times about hearsay, etc, but he ended up overruled on most of them.
The prosecutor then had to get his last jab in, "So, this whole house of cards that she had built up on fraud and deceit, what kicked out the card that caused it to all came down around her?
"What it all boils down to is how she treated my wife that day. Had it not been her assertion of that strip of land being private property, I probably would never have done the digging that I did. But had she not been so rude to my wife, it's probable that I would have just let it go at that, and that I wouldn't have shared my findings with the entire neighborhood."
I wasn't able to be in there for any of the other testimony since it could have tainted my testimony, but in the end she was found guilty of easily a half dozen misdemeanors and at least 10 felonies.
I haven't been able to pull up the court records to get an exact count of which were which, but most of those were from new victims she had defrauded since the HOA scam fell apart.
There were a couple of more technical violations of the law interspersed (I believe they were specifically relating to shenanigans she pulled as a real estate agent), but fraud is the bulk of what she was convicted of. Sentencing was rather anticlimactic, she got pinged for about 10 years, but talking to the prosecutor about it she will likely serve 5-6 years actually incarcerated.
Her house is in foreclosure. Not sure when the auction is going to happen, but she had already moved out by the time it was officially foreclosed on. And she's still facing heat on the federal side. No idea what's going to be happening there. I'll probably find out if/when they request that I testify.
I do want to address what some people have said in previous comments. That I'm taking this too far, that I'm taking too much glee in what's happened to her, that I'm a revenge bully. When I sent the letters to the neighborhood, I expected that the fake HOA would be disbanded, and not much more.
I was somewhat surprised to hear about lawsuits, and I will admit to a certain degree of schadenfreude at seeing her knocked down a peg or three. But I had no idea how this was going to snowball. It's gotten to the point where I do somewhat feel bad for her. Like maybe I've taken this too far
But I have come to the realization that had she not been scamming people, none of this would have happened to her. While I may have been the one that kicked out the bottom card of that house of cards, I had no idea how massive this was. And so I save my pity for her victims.
Most of them probably won't ever get back what they lost to her. Some did, early on. But that's a fraction of her victims. The rest? I highly doubt it. Last time I looked at the court records, she was named as defendant in at least a half a dozen lawsuits.
I suspect that number has grown since then. I guess what it all boils down to is that if you're scamming people, don't piss off your neighbors. you never know what they might dig up.